Health Care Museum Essay

Development Description Analysis (How does the development affect the current U.S. health care system?) 1. Surgery A surgical procedure is medical treatment that involves a physician cutting into a patient’s body to repair or remove something. Surgery procedures have existed since prehistoric man. In 1540 C.E. barbers and surgeons united to form The United Barber-Surgeons Company. These barber-surgeons performed tooth extractions and bloodletting procedures. As our knowledge grows, so do our abilities. Some procedures such as tracheostomy, described in detail by Paul of Aegina (625-690 AD), remain pertinent today while others which contributed to the demise of many patients (e.g. bloodletting) were surprisingly slow to disappear (Hindle, K. S., & Hindle, S. J., 2001). Surgeries save many lives. Today surgeries are used for replacements and transplants. Elective non-life threatening surgeries are performed quite commonly now. Microsurgery uses small incisions to minimize exposure and reduce the impact of the procedure all together. There is also cosmetic surgery which is usually elective an d not medically necessary. With today’s surgical practices the body can be manipulated in many ways with minimal effect. 2. Technology Technology is the creation and usage of tools for achieving goals. In health care, technology is used for information purposes, to teach, and heal. We have computers that keep track of medical records. We have machines that can see through the human body. There are sensors that can collect data from a patient and transmit it wirelessly to a physician. There are even machines that aid physicians during surgery. Technology completely affects health care. It has allowed patients and doctors to stay connected better than ever. Telecommunications provide health care workers with the ability to  communicate with each other all around the world. Technology has allowed for easier storage and access to medical information. Health care workers can locate a patient’s information with the click of a button. Patients can go online and access a plethora of health information. Technology also enables us to view the body in new ways (CAT scan, x-rays). Robotics allow physicians to perform s urgeries in places where they cannot be via remote link. 3. Child Birth Beginning back in the Renaissance era barber-surgeons provide child birth services. Much later in 1716 midwives were given the ability to obtain licenses and help women through labor. Shortly after the war of 1812 medical schools began teaching birthing techniques to physicians. By the 1900’s physicians attended approximately half of the nation’s births. Child birthing at hospitals performed by physicians are much safer than the â€Å"home births† of yester years. With hospitals the patient’s area is always clean and sterile. This reduces risk for the mother and child. With physicians as the primary deliverer, complications can be handled sooner and adequately. These techniques have allowed the safe birthing of millions. This protects are future generations by keeping them safe. 4. Vaccines As the United States grew toward independence in the 1700’s, public health efforts also grew. In 1796 Dr. Edward Jenner created and tested the first vaccine (Henderson, D. A., 1997). After word of the discovery two London doctors confirmed Jenner’s findings and began wide distribution. Within 3 years the information was translated into 4 different languages and spread across 4 continents. The success of vaccines has led to a situation where many health care providers and parents have not witnessed the morbidity and mortality of the diseases for which these agents are indicated (Ruddock, B., & Malak, K., 2005). Vaccines offer protection from numerous disease. Without vaccines illness would be far more rampant. 5. Medicare In 1965 President Johnson signed into law the Medicare program. Medicare provides medical access for citizens 65 and older who cannot afford care themselves. Over time the coverage has expanded to include disabled citizens  and those with end stage renal disease. Medicare gives medical access to many people who would not have it otherwise. Medicare is the government’s first program associated with public health insurance. Since then the U.S. has seen Medicaid and now recently the Affordable Care Act. Essentially, these are government programs designed to ensure care for citizens. These programs expand health care. As more people are able to have health coverage, more health care services become needed. While these programs provide protection they also stimulate growth within the medical field. Part 2 How does everything connect? Write up a comprehensive overview of how these events evolved into each other. First on my list is surgery. While child birth has been around since the dawn of man, modern birthing practices did not come into effect until the 1800’s. Surgical procedures on the other hand, have been dated back to 6500 hundred years before common era (BCE). Skulls found in France show signs of a rudimentary surgery called trepanation, which involves drilling a hole in the skull. (Heisler. J., 2014). Surgery has been a major health tool for a very long time and we are still improving upon it today. Technology comes second on the list because ever since man realized he could manipulate the body, tools have been needed to do so. Even the skulls in France required some sort of tool to drill the hole. Of course technology goes beyond simple tools. Technology encompasses numerous devices each with their own unique quality. Technology expands our capabilities and allows us to do things we simply could not do ourselves. Technology also improves child birthing techniques. Thanks to sonograms physicians can see babies inside of the womb. This gives them great insight into the condition and development of the child in the womb. Before technology such as this, parents had to wait till the day of birth before they knew anything about the child. Next on the list are vaccines. While child birth did not directly influence the invention of vaccines, technology in fact did. Without the tools to collect and hold specimens, Jenner would never have been able to conduct his research. Additionally, vaccines have improved the health status of everyone  including children. Thanks to vaccines, children (and ultimately the population) no longer have to worry about Polio and other various viruses. Most required vaccines are given to children during their developing years. This protect the child through their entire life. Last of the developments is Medicare. Vaccines didn’t directly lead to Medicare, however all other developments did. With surgical procedures, technology, vaccines, and better child birthing practices, more people are able to live longer lives. As the population’s life expectancy increases, so does the need for care in all facets of life. Programs like Medicare protect the elderly by providing health care for those who could not afford it on their own. Essentially, social policies eventually become important for societies that can provide health care. Medicare, Medicaid, and the Affordable Care Act are necessary social devices that protect U.S. citizens. References Austin, A., & Wetle, V. (2012). The United States health care system: Combining business, health, and delivery. (2nd ed.). Upper Saddle River, NJ: Pearson Education. Lemelson-MIT. (2003, April). Louis Pasteur. Retrieved from http://web.mit.edu/invent/iow/pasteur.html Henderson, D. A. (1997). Edward Jenner’s vaccine. Public Health Reports, 112(2), 116-21. Retrieved from http://search.proquest.com/docview/230183418?accountid=458 Ruddock, B., & Malak, K. (2005). Sorting out risks, benefits of vaccine. Canadian Pharmacists Journal, 138(5), 59-60. Retrieved from http://search.proquest.com/docview/221177193?accountid=458 Hindle, K. S., & Hindle, S. J. (2001). A history of surgery. Royal Society of Medicine (Great Britain).Journal of the Royal Society of Medicine, 94(8), 423. Retrieved from http://search.pr Heisler. J. (2014). The Evolution of Surgery. Retrieved from http://surgery.about.com/od/surgeryinthemedia/a/HistoryOfSurgeryTimeline.htm

How Great Companies Think Differently Essay

This article highlights principles that leading companies employ to differentiate them from other companies that focus only on profits. These leading companies attempt to transcend the short-term bottom line mentality and aim at social involvement that will produce longevity and sustained profits over the long haul. Part of making money in the long term is longevity, and the way to longevity is to build an â€Å"enduring institution†. This is done through being more socially conscious and planning for better quality of life for employees including a healthy work life balance, and to provide a meaningful life purpose for workers that build people and society. The point is to remain financially viable for the long term because that’s the best way to serve society, the employees, and consumers. Key Takeaways 1. Businesses must invest in employee empowerment and engagement, and must adopt the attitude that employees are interested in more than just a paycheck. Companies must balance public interests with financial concerns, and attempt to improve the lives of consumers. Viewing the company as a societal institution and communicating a common purpose provides an identity for employees and helps protect against uncertainty. A larger purpose and vision inspires employees to think bigger and beyond the four walls of the company. 2. Business should have a clear, long term focus on a higher purpose than just financial achievement. This is achieved by investing in â€Å"the human side† of the organization. Listening to the interests of employees and possibly offering opportunities to pursue those under a sort of corporate sponsorship. Doing so should lead to deeper emotional connections to the company, which again supports longevity. 3. Moods are contagious. Moods can transmit institutional values, inspiring positive emotions about the company. It is therefore vital that leadership model the behavior that supports the long term corporate/social vision. If values are clear and well understood, they can be appealing to employees. Having employees who are emotionally engaged with the values gives them a sense of purpose greater than corporate goals, and feeds longevity because employees are bought in to the corporate values rather than a personality. 4. Globalization detaches the company from a single specific society. The global markets require purpose and vision that goes beyond a single company or societal group. This is positive because it feeds innovation and cultural sensitivity to the markets the company serves.

Case Study on Operational Management Essay Example for Free

Case Study on Operational Management Essay Confession: during my dating youth, no matter how much I liked a girl, no matter how much I wanted her and just her exclusively, I’d never tell her that purely for fear of looking weak and pathetic. If we were ever to move beyond the vague, undeclared status that characterizes every relationship in its early phase, well, that would be up to her. Most guys think this way. The problem with this strategy is that sometimes, a guy likes a woman so much that he’d rather not wait for her to initiate The Talk. Or, if you’re like me, you’re over 30 and generally cranky and impatient, so you’d like to know where things stand before too many months of amorphous pseudo-commitment go by. The challenge is to share your feelings in a way that will help you get what you want and won’t make you seem like you’re groveling and/or desperate. Here are some tips to keep in mind. This should seem obvious, but guys can still be presumptuous and make all kinds of embarrassing mistakes. â€Å"I was seeing this girl and I changed my Facebook profile to say ‘In a Relationship,’† admits PJ. â€Å"And she was like, ‘Who are you in a relationship with?’ I was like, ‘You!’ I could tell she wasn’t exactly happy about it.† The lesson: You have to get her to say â€Å"yes† to the idea of dating exclusively before you are in fact dating exclusively. This brings us to our next piece of advice†¦ Browse Local Singles at Match.com on Yahoo! Make sure there’s a good chance she’ll say yes The conventional wisdom is that women are always ready to have a boyfriend. And maybe that was true during the Eisenhower administration. But in the present day of Facebook and the near limitless possibilities of online dating, it is just as likely a woman wants to have what is euphemistically known as â€Å"having fun.† â€Å"Be really careful if she’s just finished a long-term relationship,† says James, a chef. â€Å"Or if she doesn’t return your phone calls right away. If your calls are going right to voicemail, and she doesn’t call you back for like eight hours, she doesn’t want you to be her boyfriend.† The guiding principle in asking a girl to be your girlfriend is to not appear desperate: No matter how good your intentions, you may never recover from it. â€Å"My boyfriend bought me a necklace and literally got on his knees and asked me to be his girlfriend,† says Shelia, a web designer. â€Å"I said ‘yes,’ but it was a little much.† Even less dramatic overtures can still feel over the top. â€Å"I was at dinner with this girl, and I took her hand and said ‘You know I’m not seeing anyone else,’† says Zach, a lawyer. â€Å"I thought we’d have this romantic moment, but she just looked at me like I was crazy.† Given that overboard gestures might make a woman uncomfortable, consider doing what most men do best anyway: asking in a more laid-back manner. Make sure the venue in which you’re asking is mellow as well — no fancy dinners, no propositions in front of family, and so on. Remember: You want to be in the kind of circumstances where her saying â€Å"no† won’t leave you feeling like a dolt for an extended period of time. â€Å"I think while you’re walking her home or driving her home is good,† says Eric. â€Å"That way you’re not stuck at some restaurant with this giant rejection hanging over you if she says no.† So how should you cough it up? A simple â€Å"Hey, I’ve been wondering whether we should date each other exclusively. What do you think?† should work just fine. It reveals your intentions, and yet leaves the door way open for her to say no thanks, she’s not ready for that yet. Another natural segue is if introductions will soon be in order — say, she’s meeting your friends and you’re wondering if you can say she’s your girlfriend. Or consider my friend Rebecca’s story: for around six weeks, she’d been dating this guy who was on break from grad school. â€Å"Then one weekend he was about to leave to go back to school,† she recalls. â€Å"And right before he left he said, ‘By the way, when I tell my friends about you, can I call you my girlfriend?’ I loved that!† Consider ending the relationship if she says no This is a good idea for two reasons. First, there’s nothing sadder than hanging around a girl who wants you a whole lot less than you want her. Remember high school, when you were in love with the girl who only wanted you as a friend? Well, it’s worse, since you’re getting enough relationship crumbs from the table to keep you involved, but not so few that you’re moving on with your life and trying to meet someone new. Second, by moving to end the relationship, you force her to consider life without you†¦ and she has to decide if that’s doable for her. Women are stereotypically the ones who use this tactic: â€Å"Marry me or I’m out of here;† â€Å"We need to settle down or I need to move on,† etc. And the only time we realize how much we love and need them is when they’re out the door. So learn from women. If you’ve done everything else right — you’ve asked her casually, you’ve made sure all the signs that she likes are there, and she still says no — tell her â€Å"I think you’re great, but I’m interested in something more serious.† You might leave with a heart that heals fairly quickly. Or you might get a call from her within a week or two, asking if when she tells her friends about you, she can call you her boyfriend. Steve Hamilton is a New York City-based freelance writer. Case Study on Operational Management. (2017, Jan 19).

Shortcomings of the healthcare system in the U.S Assignment

Shortcomings of the healthcare system in the U.S - Assignment Example Measurement must be both comprehensive and innovative to entail the data domains of processes, outcomes, cost and patient satisfaction (Stanhope & Lancaster, 2012). Stanhope and Lancaster, in Chapter one of the book, present some evidences of how the healthcare system has transformed. They argue that an ideal system should focus on every patient while prioritizing population health to improve and manage epidemic conditions such as heart diseases, obesity and diabetes (Stanhope & Lancaster, 2012). In providing improved patient outcome, translational biomedical research should be included in an ideal healthcare system, and constant research is thereafter required to establish the clinical interventions outcomes in the best patient outcomes. Additionally, the movie â€Å"Opening Doors: Public health Nursing in its 100th years† directed by Stephen Longstreth highlights public health nursing profession that involves nurses reaching-out to homes and communities they are serving. Thi s documentary educates nurses on the importance of population-centered healthcare in the community. Nurses’ commitment to the community and families in which they live is significant in the prevention of illnesses (citation). According to the movie, nurses should be involved in tackling issues such as teen pregnancy, healthcare counseling, and substance abuse for people who have a limited access to social and healthcare services. This is because their direct participation in addressing health care problems, in their communities, is a crucial role for nurses. Better System Performance In simpler terms, an ideal healthcare system should be systems-oriented. This implies that patients must enter into an experience, which is established around them and... Shortcomings of the healthcare system in the U.S This paper, therefore, provides descriptions and characteristics of an ideal healthcare system that is consistent with the current Healthcare Reform Movement. It then compares nursing practices with the concepts of population focused nursing that are presented in the text â€Å"Public Health Nursing: Population-Centered Health Care in the Community† and movie â€Å"Open Doors† (1990). An ideal healthcare system offers three key principles, which include better system performance, better patient outcome and better professional development. The main goal of such a system is to ensure that all American citizens have an equal access to quality healthcare services at a reasonable cost. Better Patient Outcomes: An ideal healthcare system should focus on population and patient outcome. Better outcomes are acquired through care that is family and patient –centered, preference sensitive and evidence centered. Chapter one and two of the reading describe â€Å"Perspectives in health care and population-centered nursing† and â€Å"Influences on healthcare delivery and population-centered nursing†. In simpler terms, an ideal healthcare system should be systems-oriented. This implies that patients must enter into an experience, which is established around them and in-line with their needs. This experience should, therefore, be longitudinal, cross-departmental, will center and interdisciplinary on patient and their families through a healthcare journey.

Superbugs and misusage of antibiotics Essay Example | Topics and Well Written Essays - 2250 words

Superbugs and misusage of antibiotics - Essay Example However, the common used of antibiotics is for bacterial resistance. The discovery of antibiotics was only possible in the 19th century (History Learning Site 2013). One of the main contributors to the development of antibiotics was Alexander Fleming. He accidentally discovered penicillin in 1928 from a culture plate of Staphylococcus bacteria (FAS n.d.). The culture plate had been left unattended during a two weeks vacation and became invested with Penicillium notatum mold (FAS n.d.). In the plate, he noted there was a clear space surrounding the yellow green mould. The observation led to a postulate that Penicillin was capable of limiting bacteria growth (FAS n.d.). In later periods, other researchers took over and were able to purify penicillin. Moreover, there was more production of penicillin in pharmaceuticals industries for treatment of soldiers during World War II (FAS n.d.). Consequently, penicillin was used in the treatment of pneumonia, diphtheria, syphilis, gonorrhoea, an d many other infections (FAS n.d.). Since this period, there has been the emergence of various antibiotics. On the other hand, there has been increased use of antibiotics in hospitals and patients. As a result, the constant use and reliance on antibiotics have led to their abuse. Consequently, this has led to antibiotics resistance with disastrous consequences to the community and health care sector. One of such bacteria is Methicillin resistant Staphylococcus aureus (MRSA). The bacteria have been popular especially in British hospitals. A study carried out showed that MRSA bacteria in the United Kingdom were more than 15 times as compared to the safest countries (Marsh 2013). A reflection on MRSA helps in highlighting its impact, ways of spread, treatment, prevention and public health participation by society and politician. The antibiotic resistance has become an area of concern. The resistance occurs when strains of bacteria in the human or animal body becomes resistant to antibi otics due to poor use and abuse of antibiotics (American College of Physicians (ACP) 2013). Some of the resistance develops in hospitals. This is because in hospitals, there is usually administration of millions of doses of antibiotics in a day (ACP 2013). As a result, there is increased chance of developing resistance in hospital as compared to other sectors. Moreover, some of the prescription may be faulty. This may occur as the doctors prescribe the use of antibiotics for cold, coughs and other viral infections (Pechere 2001). On the other hand, there are those individuals that demand physicians to authorize the use of antibiotics just because of common cold. Moreover, other gets antibiotics over the counter. Consequently, most of antibiotics are taken for control of viral infection instead of bacterial disease. Therefore, failure to test by physicians leads to increased dose of antibiotics taken for viral disease. Consequently, majority of antibiotics are abused and misused. On the other hand, failure to complete the dosage of antibiotics as prescribed by doctor lead to the development of resistance (ACP 2013). Therefore, the improper use and abuse of antibiotics has contributed significantly to the development of antibiotic resistance (ACP 2013). Various types of superbug have emerged today. One example is the Vancomycin Resistant Enterococci (VRE) (Australian Broadcasting Corporation (ABC) 2000). However, its problem arose in 1996 as it was in hospital patients in Australia (ABC

China Kitchen Case Study Example | Topics and Well Written Essays - 1750 words

China Kitchen - Case Study Example ethical and legal issue brought up in the Kitchen Best case invites ethical questions when doing cross-boundary business in Southern China and the risks associated to such business practices and how could such behavior/s be avoided in the future. The ethical and to certain extent legal issues that beset Kitchen Best became apparent at the end of 2009 when Malaysia-based distributor Shago commission a European designer to come up with a range of appliances for its 40th anniversary collection. Shago then placed orders with Kitchen Best with some of appliances ordered came with a special gift set of microwable tableware. Shago however complained that the bowls and plates in the gift sets were not microwable and this is breach of contract where Shago demanded both a refund and compensation. Upon investigation, it was found that Sze, Kitchen Best’s purchasing and production manager who had been responsible for sourcing the gift sets had awarded the contract to a factory in Dongguan that was owned by his brother-in-law. In return for the order, Sze and his wife were offered a free package tour to Europe. Wei, who knew about the personal relationship between Sze and the factor owner, had not reported it in view of their rela tionships with Li. When in-house testing later showed that the product was faulty, she informed Sze, who told her he would handle it. However, no remedial action was taken and Wei decided not to pursue the matter any further. This incident was followed by the incident with Haus de Metro where bribery happened in the testing and certification of samples. This occurred when a shipment that was sent to German retail chain Haus de Metro did not meet the company’s safety requirements contrary to the satisfactory testing report received by Kitchen Best. Kitchen Best had subcontracted HdM’s orderfor electric water dispenser to Qinghua Electrical Appliance Ltd as its own production lines were fully occupied. Kitchen Best arranged for Keemark

Fashion trends Essay Example | Topics and Well Written Essays - 1250 words

Fashion trends - Essay Example The research "Fashion trends" identifies and analyzes the basic scopes of their targeted customers. The research design drew from the theme of the products the students intended to sell. Before the commencement of the research, the students analyzed the theme context of the prospective products. The analysis encompassed several dimensions. Firstly, there was an identification of the types of products to sellable to the target customers. The second dimension encompassed the designation criterion of the product to suit the customer’s taste. The third dimension encompasses identification of the price standards for the designs. Finally, there is the dimension of presumed product’s lifecycle within the supply chain. Therefore, in setting the product’s theme, identification, analysis and description of the target customers is critical for the business before initiating the intervention. Having established the study theme for the product, and with sufficient literature reviewed on the fashion trends in the entire country with special emphasis on the city of London, the students the researchable question becomes known. From the foregoing sequences of events in the fashion and apparel industry, the researchable problem statement becomes: How can there be an enhanced reach-up among the youths bracket customers with fashion and design trends in London? The research employed a wide range of methods in data collection. The methods differed according to convenience, region and information required.

Generally Accepted Accounting Principles Essay Example | Topics and Well Written Essays - 1500 words

Generally Accepted Accounting Principles - Essay Example Generally Accepted Accounting Principles It is the core responsibility of the board of directors to ensure that the company’s financial statements are honest. The auditors perform a check on these financial statements to ensure that they reflect the true and fair view of the respective organization. An audit tests the authenticity of the financial statements and their validity for use by the public. The internal users of these statements are the management and the board of directors while external users include; shareholders, investors, tax authorities, and the interested public. Therefore, all public listed organizations must make their financial statements accessible for all. Presenting the true and fair view of financial information has faced criticism from analysts due to the recent financial scandals. Disclosing financial statements is an activity subject to fraud and misconduct from the relevant bodies. Financial scandals arise from this disclosure as organizations tend to; misusing funds, overstating the value of organization assets, overstating revenues, understating expenses, or the underreporting the existence of liabilities. Financial scandals are often orchestrated by the organization’s officials, which include the board of directors, who, sometimes, tend to collude with the auditors. A board of directors is an independent body, either elected or appointed, to oversee the activities of an organization. A company’s board of directors must include individuals responsible for the functioning of the accounting department.

Sales and purchase Essay Example | Topics and Well Written Essays - 1000 words

Sales and purchase - Essay Example The input data that is required are item category, brand, quantity, cost, customer detail (name, address, phone and birthday), mode of payment, mode of sale and special scheme (e.g. discount). Once these data are entered into the system, it undergoes various processes before finally culminating in the delivery of the item. These processes can be broadly classified into six main areas; 2. The system then differentiates the mode of sale and categorising it into direct sale order or internet based order. This gives the management to make appropriate strategies and plans for their existing or emerging market. 3. With category and brand specified, it then checks for the stock status so that in case of any shortfall, alternative brands can be suggested or sold. This information (category and brand) also help to market other products that may add value to the items asked for. 4. The system then checks for any special offer or discount that the item might have at that particular time. This is an important process because the current market scenario has necessitated introduction of special schemes to attract customers in order to main their competitive edge. 'The ultimate schedule (discount) is one which maximises the suppliers' resultant economic gain, but does so at absolutely no added cost to the buyer' (Monahan, 1984). 5. If the mode of payment is other than cash transaction, the system performs credit check for the customer and accordingly, informs and suggests the customer for alternatives for payment schedules. 6. The system then confirms or refuses the sale/ purchase order and sends the same information on the terminal and generates invoice or sale/ purchase receipt. The completion of sales order is but the first of many other requisites of the input information that are essential for the management of the company. The growth and the future prospects of the business depend on the input data as they are able to divulge vital information about the products and the customers. The sale processing data helps the management to disseminate information that can be categorised into the following output formats; 1. The input data helps to generate current inventory status so that the products that need fresh stocks can be ordered much in advance. 2. The data also helps the management to assess the order flow pattern of the products and services so that the management is able to take appropriate steps in meeting the demands of their customer either by increasing the shopping hours or employing more staff to deal with the rush. This helps the management to maintain a high level of customer satisfaction and general efficiency. This applies both to the days of the months and the specific hours of the day, during which there is marked difference in the sales and purchase pattern. 3. The data also help in finding out the popular items which are sold or purchased as well as the brands that are preferred thus helping the firm to introduce items or products that add value to the ones that are already popular. 4. The management can also maintain its client base by making efforts to

Metamorphosis Essay Example | Topics and Well Written Essays - 500 words

Metamorphosis - Essay Example He lived to find food, provide shelter, eat rubbish, just to survive and protect the species. According to Karen Bernardo's commentary (n.d.), his metamorphosis confronted him with "the greater questions of existence." When Gregor awoke to find himself "transformed in his bed into a horrible vermin" (Kafka, 1), he reacted as if he had to work and fulfill his duty, a surprising attitude, in the circumstances. Instead of being horrified at the changes in his body, Gregor dealt with it, first as a dream, then just an odd transformation that would not stop him from working and being the same person. He continued to think of ways to get over the problem and get to work, which is a confusing reaction for the reader, as it was a terrifying situation to be in. It was absurd that he continued to think and feel as both beetle and man, but in reality, the person who was Gregor still existed, trapped in that awful body. The metamorphosis gave him time to think and examine his life, the family, and his own place in the world and showed he was still human. When his mother and sister cleared out his room, he felt "they weretaking away everything that was dear to him" (Kafka, 24). He crept out to listen to Grete's music, asking "Was he an animal if music could captivate him so" (Kafka, 33).

The Role of Engineer in Nation Building Essay Example for Free

The Role of Engineer in Nation Building Essay Why should a privileged person help an underprivileged person? As the definition suggests that the privileged person is someone who is having the special rights, advantages or immunities or having the rare opportunity to do something that brings particular pleasure. On the other hand the unprivileged person is someone who is not enjoying the same standard of living or rights as the majority of the people in the society. So in a socio economic point of view the presence of both the class cannot be ignored but with proper ratio. A society can’t only have one of the two to improve or else we can say the wheel of the society can’t be moved freely without the presence of the two but of course there should be a proper balance between these two. The law of the nature says that the stream flows from the top to bottom likewise the privileged person should come and hold the hand of the underprivileged person to move the society in a proper pace. Now it’s the time to think of the human values and morality of a human being if he/she is gifted with some advantages or right then it’s the duty of them to come and help the people who are deprived of. On the other hand the underprivileged person should be thankful and have sense of gratitude for the person whom he/she is grateful in any sense be it money, values or spiritualism. Even Mahatma Gandhi told this in another aspect such as: I want to write many new things but they all must be written on Indian state. I would gladly borrow from the west when I can return the amount with decent interest. So borrowing things from others is not a crime but one should not forget about to return with something greater to the person whom he/she is grateful to. This is a cycle of civilization and one can’t break the chain. The society is mixed with people and cultures, one should be aware of the fact that everybody is equally important and they should help each other to form a warm and healthy atmosphere to live for the next generations to come. Even the Nobel Laureate Amartya Sen in his book The Idea of Justice (2009) explained that ideal democracy demands to take from the rich and use honestly and wisely for the people. Moreover, Sen notes that in famines only a very small proportion of the population is affected—much less than 10%. Political pressure from this group alone would not be enough to force a democratic government to respond. It is the pressure from the non-suffering members of society that makes the difference. But if government officials in democracies don’t care about the starving unless they are threatened with a loss of power, why do members of the population who are not starving care about the starving? It seems that if compassion or solidarity moves non-starving citizens to advocate for famine victims, it would move government officials to respond to the famine. Even Bentham and Mill explained that west democracy instills an idea for the greatest good of the largest number. M.K.Gandhi denies the principle and said that it should be greatest good for all. So on a nutshell we can conclude that for maintaining a true democracy it is the need of an hour to help unprivileged people for the greatest good of the civilization.

Comparison Essay Example for Free

Comparison Essay Both of Emily Dickinson’s poems are about death. â€Å"Because I Could Not Stop For Love† is more about the cycle of life than death. â€Å"I Heard a Fly Buzz When I Died† relates to the final moment before death. Emily Dickinson’s poems are both centered on death; â€Å"Because I Could Not Stop For Death† is based more around upbeat and happy scenes, as where â€Å"I Heard a Fly Buzz When I Died† talks about the preparation before death. Although both poems have very different meaning, the two poems both focus on the ending of life. In the last line of â€Å"Because I Could Not Stop For Death† Emily Dickinson says were toward eternity. In Dickinson’s second poem it says, now she waits for the king to come. In the first poem Dickinson refers to eternity meaning after death living for forever. In the second poem waiting for the king to come relates to the end of existence, when the king comes back to take us all. In â€Å"Because I Could Not Stop For Death† has a happy ending and is a very appealing poem. Dickinson describes a girl being picked up in a carriage for all of life’s journeys. Where Dickinson’s second poem was a serious poem, describing the build up right before death. She mentions the stillness in the air, and breath-gathering firm. One poem is very heart warming and, the other is very serious. These poems ultimately have the same meaning, but both take a different look at death. The first poem contains the process of life before death, and how she is working for a new beginning. Dickinson’s second poem talks about her death being the end of everything, Dickinson even mentions decaying in the grave. The first poem has a positive outlook on death, and the second portrays a rough end to life.

Characterisation of Prostate Cancer Stem Cells

Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20–24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin ÃŽ ±2ÃŽ ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37 °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 ÃŽ ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20 µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70 °C and thawed at 37 °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600 µl of RLT Plus (10 µl of ÃŽ ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700 µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700  µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500  µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30  µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80 °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturer’s instruction 2  µl (2  µg) of previously prepared RNA was added to 1 µl of 50uM oligo (dT)20, 1 µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10  µl. The reaction tube was incubated at 65 °C for 5 mins and then placed on ice for one min. In another tube 2  µl of 10X RT buffer, 4 µl of 25mM Mgcl2, 2  µl of 0.1DTT, 1  µl of RNaseOUTTM (40U/  µl) and 1  µl of SuperScriptTM III RT (200 U/  µl) was added. The 10  µl mix of the first tube was added to the second tube and incubated for 50 mins at 50 °C. The reaction was terminated by incubating at 85 °C for 5mins and then chilled on ice. 1  µl of RNase H was added to the tube and incubated for 20 mins at 37 °C. The total yield of cDNA was 25  µl and this was stored at -20 °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5  µl of 10xPCR buffer II, 3 or 6  µl of 25mM MgCl2, 4  µl of 10mM dNTP, 1  µl of forward and reverse primer at 10  µM and 0.25  µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/ µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94 °C for 6 min, and then 35 cycles of 94 °C for 30 secs, 55 °C for 30 secs, 68 °C for 30 secs, 72 °C for 30 secs followed by 72 °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: †¢ A reporter dye (6-FAM) linked to the 5 ´ end of the probe. †¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 ´ end of the probe 5 ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 ´ end and a quencher dye at the 3 ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10  µl of final volume of TaqMan mix was placed. The mixture included 5 µl of TaqMan Gene Expression Assay, 0.5  µl of the primer, 0.5  µl of GAPDH (endogenous Control) and 4  µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50 °C for 2 min, followed by 95 °C for 10 mins. Then 40 cycles of 95 °C for 15 secs and 60 °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/ µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RT—PCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/ µl for C42B and 190ng/ µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/  µl, 5ng/ µl, 20ng/  µl and 50ng/  µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient ≠¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/ µl, 5  µl, 20  µl and 50  µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 ≠¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ã‹â€ Ã¢â‚¬  Ct à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ã‹â€ Ã¢â‚¬  Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct is calculated by subtracting the à ¢Ã‹â€ Ã¢â‚¬  Ct value of the adherent cells from the à ¢Ã‹â€ Ã¢â‚¬  Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ΔΔCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, ÃŽ ±2ÃŽ ²1 integrin, Sca-1 and ÃŽ ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. ÃŽ ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumour–initiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp

Law and Economic Literature :: Economic Environment, Trading Regulations

Law and economic literature on insider trading can be categorized into two categories- agency theories and market theories of insider trading. Agency theories of insider trading deal with the impact of insider trading on firm-level efficiency and corporate value (Jensen and Meckling, 1976). On other hand, Market theories of insider trading analyze the implication of insider trading on market performance (Bhattacharya and Daouk, 2000) e.g. the cost of capital, liquidity and market efficacy etc., for example, Manna (1966) suggests that the insider trading allows stock markets to be more efficiency. Surprisingly, most of the debates on insider trading are concentrated on U.S markets (Beny, 2005).La Porta et al (1998) claim that law and its level of enforcement vary according to countries’ infrastructures, and differences in law and its enforcement may explain variations in market structures and stock market practices among different countries. Moreover, Maug (2002) presents a mat hematical model in which a dominate owner has information advantage over small shareholders where insider trading regulations are not properly enforced. Besides, Leland (1992) argues that if the insider trading is allowed, stock prices reflect better information at the cost of less liquidity that magnitude depends on economic environment. Baiman and Verrecchia (1996) argue that the level of insider trading varies with level of financial disclosure, the culture, and the economics of different countries. Therefore, it can be expected that the impact of insider trading activities on the stock market varies country to country. Bhattacharya and Daouk (2002) address the effect of insider trading regulation and its enforcement on the cost of capital by taking 51 countries over more than 20 years, and they summaries that insider trading regulation and its enforcement of different countries help in reducing the cost of capital of firms. Even though, the magnitude of effect varies with the level of enforcement of a country. Moreover, Beny (2005) does an attempt to find whether insider trading law matter on Ownership dispersion, stock price informativeness and stock liquidity. In empirical results, he finds that Ownership dispersion, stock price informativeness and stock liquidity are greater where insider trading law and its enforcement are more restricted. Moreover, the most important aspect of the formal law is penalties or criminal sanctions that are imposed on who violates insider trading law. Fernandes and Ferreira (2009) argue that insider trading regulation and its enforcement improve the informativeness of stock prices, but this improvement is concentrated in developed markets.

The Mystery of Sleep Essays -- Essays Papers

The Mystery of Sleep ~ Rest for the body, Activity for the brain ~ Everyone sleeps. While humans sleep, they do not procreate, protect, or nurture their young, gather food, earn money, write papers, etc. Surely, at least once, most people have wondered why they sleep in spite of these disadvantages. According to Greier (48), it is hard for scientists to answer the seemingly simple question of what, exactly, sleep is good for. Sleep occupies one-third of humans' lives, which seems like a waste of precious time; however, no one can survive without sleep. According to Shelton (5), sleepy drivers in the U.S. cause approximately 56,000 car accidents every year. Also, Wolfson and Carskadon (875) report interestingly that the students who achieve good grades sleep longer than the students who are struggling or failing in school. Furthermore, the nuclear accident at Chernobyl, the near meltdown at Three Mile Island, the environmentally disastrous oil spill by the Exxon Valdez, and the loss of the space shuttle Challenger were all caused by people who made m istakes because of too little sleep (Coren 1). Sleep deprivation seems to cause detrimental effects to humans' daily lives. Sleep is a state marked by reduced consciousness, diminished activity of the skeletal muscles, and depressed metabolism. Humans normally experience sleep in patterns that follow five observable, progressive stages (stages 0~ 4) of non-rapid eye movement (NREM) sleep and a separate pattern of rapid eye movement (REM) sleep (Coren 31). An electrical encephalogram (EEG), devised by Hans Berger in 1919, is used to measure electrical activities of neurons during the stages: Stage 0 is not real sleep, but going to bed and preparing for sleep. During stage 1, th... ... (1997): 48-50. Hobson, Allan J. {Sleep}. New York: Scientific American Library, 1995. Meddis, Ray. {The Sleep Instinct}. Boston: Routledge & Kegan Paul, 1977. Moreno, Anne. "Why We Sleep? Getting a Good Night's Sleep Is Important to Your Health and Also to Your Success in Life." {Current Health 2} 25.2 (1998): 6-13. Rechtschaffen, Allan. "Current Perspectives on the Function of Sleep." {Perspectives in Biology and Medicine} 41.3 (1998): 359-90. Shelton, Deborah L. "Sleep-Deprived Drivers Linked to Highway 'Carnage'" {American Medical News} 38.26 (1995): 5-6. Stampi, Claudio, ed. {Why We Nap: Evolution, Chronobiology, and Functions of Polyphasic and Ultrashort Sleep}. By Jurgan Arnoff. Boston: Birkhauser, 1992. Wolfson, Amy R., and Mary A. Carskadon. "Sleep Schedules and Daytime Functioning in Adolescents." {Child Development} 69.4 (1998): 875-89.

One Man, One Vote? Essay -- essays research papers

One Man, One Vote?   Ã‚  Ã‚  Ã‚  Ã‚  Joseph Farkas thinks that every vote cast should equal every other vote. He feels that many people are voting without knowing why they are voting for a certain person or why they aren't voting for another. He says that a vote cast by a person with no or very little knowledge in the election should not count as much as a vote cast by a person who knows alot about the election. The people who care about who has an important role in the government should have a bigger say in who is going to have that important role. The votes cast by a person who doesn't really know why they are voting for someone should not equal as much as an election educated person.   Ã‚  Ã‚  Ã‚  Ã‚  I do not think that this is a good idea at all. It would not encourage people to learn more about the election but keep them away from the voting area. It will probably make people not want to vote because many of them would think that their vote will not mean as much to the election. It would make the people who are familiar with the candidates want to vote because they would have a bigger say in who gets elected. It would be very hard to decide who know what about the running candidates and issues that are being addressed. They would have to give some kind of multiple-choice question test that you had to fill out while voting. It would take a long time for each person to vote and I think that would make people less encouraged to come and vote. Sin... One Man, One Vote? Essay -- essays research papers One Man, One Vote?   Ã‚  Ã‚  Ã‚  Ã‚  Joseph Farkas thinks that every vote cast should equal every other vote. He feels that many people are voting without knowing why they are voting for a certain person or why they aren't voting for another. He says that a vote cast by a person with no or very little knowledge in the election should not count as much as a vote cast by a person who knows alot about the election. The people who care about who has an important role in the government should have a bigger say in who is going to have that important role. The votes cast by a person who doesn't really know why they are voting for someone should not equal as much as an election educated person.   Ã‚  Ã‚  Ã‚  Ã‚  I do not think that this is a good idea at all. It would not encourage people to learn more about the election but keep them away from the voting area. It will probably make people not want to vote because many of them would think that their vote will not mean as much to the election. It would make the people who are familiar with the candidates want to vote because they would have a bigger say in who gets elected. It would be very hard to decide who know what about the running candidates and issues that are being addressed. They would have to give some kind of multiple-choice question test that you had to fill out while voting. It would take a long time for each person to vote and I think that would make people less encouraged to come and vote. Sin...

A Time of Change in the Market Revolution Essay

1815 to 1860 was a crucial time for American commerce and urbanization that not only had strong economic influences, but also altered social and political perspectives. This time period, known as the Market Revolution, stemmed largely from the advancement in technology which led to transportation improvements and the building of railroads. Banks also contributed to the growing economy by increasing economic input and providing loans to merchants, manufacturers, and farmers. The rapid expansion of commerce and transportation had profound effects on American individuals socio-economic goals; a sense of self-confidence and domestic ideology surfaced, perpetuating westward expansion. Along with the spread of urbanization came the circulation of literary publications that fostered the spread of popular opinions; this eventually became an essential component to the many reform movements ultimately caused by the Market Revolution. All of these factors contributed to the republican ideal of individual freedom. Although the Market Revolution promoted economic and social growth through the development of technology and industry, it also led to actions threatening to republican liberties like equality and the inherent rights of man. Concerns of tyranny and disregard to the American Constitution caused many to focus on preserving the American republic through reform movements. The main driving factor of the reform movements that took place following the Market Revolution was the obscurity of republican values. Despite the positive influences the Market Revolution had on quality of life and transportation, many Americans feared the corruption of their individual liberties. They had proper reason to believe that this would be an occurrence caused by the unbalanced power that was established during the Market Revolution. One example of this unbalance was the increasing power of banks, more specifically addressed by Andrew Jackson when he vetoed the Second Bank of the United States. He asserts that the monopolized bank system undermines the rights of ordinary people because it establishes significant distinctions between classes where the upper class holds the power and dominates over the lower class. In a way, he attempts to reform the government-established powers instilled by the Second Bank of the United States by voicing how it is an abuse of power and limits economic opportunity for ordinary people. In addition to the unbalanced power created by the banks, a prominent deterrent from republican autonomy was the inequality that this instability of power caused for individual Americans. The rapid expansion of agriculture and population corresponded to the growth of slavery, which is the most pronounced example of the inequality America experienced during and after the Market Revolution. Slavery was seen by many as a direct violation of the Constitution and the inherent rights of man, which defy republican values. In the Republican National Platform, Abraham Lincoln brings to light that the inequality of slavery threatens national sovereignty, â€Å"That the maintenance of the principles promulgated in the Declaration of Independence and embodied in the Federal Constitution, †¦ is essential to the preservation of our Republican institutions; and that the Federal Constitution, the Rights of States, and the Union of the States, must and shall be preserved.† A nationalistic togetherness, while still maintaining individual freedom, is eminent in establishing and fulfilling republic ideology. Slavery was a direct violation of man’s inalienable rights, and therefore many abolitionist movements took place in order to reform the corrupt nation. Acts of slavery and other injustices initiated by the Market Revolution that defied republican values were identified as needing reform, in William H. Seward’s speech in 1855 he said, â€Å"We must restore the demoralized virtue of the nation. We must restore the principle of equality among the members of the State –the principle of the sacredness of the absolute and inherent rights of man.† The emerging Democratic party was host to many of the promoters of personal reform and social problems, while the Whig party advocated the reform of moralism and state-sponsored entrepreneurship. One of the initial influences of the reform movements was the moral mending that was deemed necessary by Protestants in order to overcome the sins occurring in society, and enact a sense of righteousness. These ideas of self-virtue and societal justice were reflected in the Second Great Awakening and the Temperance movement in the early 1800’s. The Second Great Awakening was a religious revival that had a strong influence on women, giving them a voice in society and the ability to make an impact for the salvation of American values. The Temperance movement had a similar purpose, to promote self-perfection and eliminate the many sins that became prominent in society during the Market Revolution. The movement focused on alcohol abuse and sexual sin, and although it bolstered self improvement for many individuals, a main impact of both the Temperance movement and the Second Great Awakening was the eminent duty of women to speak out against controversial happenings. Both of these movements had strong positive effects on the preservation of the republic because they fostered public regard to individual goodness, which in turn led to other reform movements and the ability for both women and men to speak out against injustices. Both women’s rights and slaves rights were distinguished issues that violated the equality of the republic, and therefore certain groups sought reform these corrupt aspects of American society. In the 1830’s, the abolitionist movement was initiated in an attempt to dissolve the sin of slavery. Although abolition became the source of immense controversy and even violence, the movement against slavery allowed slaves like Robert Glenn and Frederick Douglass to share their stories in an attempt to bring to light the corruption taking place in America. These movements did in fact help persuade many groups of people, mostly Democrats, of the Constitutional and moral violations that slavery inhibits. However, westward expansion and distinct divisions between the nation made it difficult to prevent the spread of slavery. Despite the fact that abolitionist movements did not have immediate effects on the eradication of slavery, it did open doors for public opinion and womens righ ts. In 1848, Elizabeth Cady Stanton and Lucretia Mott spoke out at the Seneca Falls Convention against the unequal status of women and how it reflects tyranny rather than the individual liberties of a republic. They emphasize the main point of both slavery and women’s rights reformations, â€Å"The world has never yet seen a truly great and virtuous nation, because in the degradation of woman the very fountains of life are poisoned at their source.† These movements did impact the protection of republicanism through the expression of activists who exposed the exploitation and inequality occurring due to slavery and unbalanced privileges of women. The Market Revolution had a domino effect on the fabric of the republic. It propelled economic growth and industrial expansion which then perpetuated unbalanced power within the government. This obscured the political values of individuals and brought about such a dramatic shift in thinking regarding opportunity and personal liberties that many people were concerned about the loss of republicanism. Members of the public like the Grimke sisters, as well as members of the government like Andrew Jackson, identified the injustices of inequality that were caused by the Market Revolution and felt as though reform was necessary to preserve the republic. The reform movements that took place, such as the Second Great Awakening and the abolitionist movement, exposed the pollution of republican ideals like individual freedom and egalitarianism. Although these messages were controversial between the sectional division of the North and South, reform movements still established a voice for the republic and eventually managed to preserve the prominent aspects of the republic. ——————————————– [ 1 ]. Andrew Jackson, â€Å"Veto Message,† in John Majewski, History of American Peoples, 1840-1920: A Primary Source Reader (Dubuque: Kendall/Hunt 2006), 5. [ 2 ]. Abraham Lincoln, â€Å"Republicans Adopt a Strong Anti-Slavery Platform,† in Majewski, 50. [ 3 ]. William H. Seward, â€Å"The Dangers of Extending Slavey, and the Contest and the Crisis,† in Majewski, 41. [ 4 ]. Roark, Johnson, Cohen, Stage, Hartmann, The American Promise: A History of the United States, 330. [ 5 ]. Roark, Johnson, Cohen, Stage, Hartmann, The American Promise: A History of the United States, 322. [ 6 ]. Roark, Johnson, Cohen, Stage, Hartmann, The American Promise: A History of the United States, 323. [ 7 ]. Roark, Johnson, Cohen, Stage, Hartmann, The American Promise: A History of the United States, 324. [ 8 ]. Elizabeth Cady Stanton and Lucretia Mott, â€Å"The Seneca Falls Convention Advocates Complete Equality† in Majewski, 24.

Ford’s E-Business Strategy

Jacques Nasser, hybridisation Motor fraternity president and chief executive officeholder announced a new view for the firm in the fall of 1999 to lead the worlds leading consumer family providing automotive products and work. Key to that dream was the shift key of the business using Web technologies. Brian P. Kelly (Kelly), interbreedings e-business vice president, described foreshorten acrosss plan to rebuild itself as a move to consumer-centric from dealer-centric, and stated that get across would translate itself from being a maker to dealers into a marketer to consumers. Kelly explained that the important objectives of fords e-business strategy were to bring speed, convenience, and knowledge to customers rather than just focusing on cost cutting. The strategy was based more or less the principle The consumer is King and using the net, customer hallows would be sent directly to factories and suppliers which get out eventually allow get oer to translate a utos to consumers within days of ordering. Some of the e-business portas that crossing put in place to transform the social club into an e-commerce smart pay back is mentioned below.Improving talent in Supply mountain chain 1. traverse believed that using the internet improved the capacity of its supply chemical chain, so in mid-1999, the come with along with Oracle, created AutoXchange that allowed online B2B transactions with its suppliers. This e-commerce tool helped interbreeding and its suppliers swap selective tuition and bids on goods and services worth nearly USD 300 chargeion. The company expected to reduce its purchasing bill by 10% through the uptake of AutoXchange. 2. Until February 2000, the company followed the push operations fashion model, only if by collaborating with GM and DaimlerChrysler, hybridization set up an online marketplace cum secluded exchange Covisint. This substantially reduced the in operation(p) cost and brought efficiency to the business. Covisint followed the pull model which allowed cross to first take the order from a customer and then manufacture the car according to the customers specifications, thereof the traditional supply chain became a demand chain. 3. To optimally practice the features of Covisint, fording launched the cross Supplier meshing (FSN).FSN was used to share information with its suppliers over the web. By increasing the flow of information between suppliers and Ford, it reduced the fomite rake time. Focusing on the Demand Chain 1. In partnership with Microsoft, Ford essential CarPoint an auto buying website in 1999. retail customers could order cars through this website. In accompaniment to developing this website, Ford also got into alliances with reputed portals give care Yahoo. com, iVillage. com and bolt. com. These alliances gave Ford insight into the preferences and buying habits of assorted segments of the society. . In late 1999 Ford accomplished that customers qu eries should be resolved quickly to get closer to those who use the net and for this it established a new e-CRM company Percepta a joint venture with TeleTech holdings. 3. In continuance with the e-CRM strategy, Ford in 2000 launched another e-commerce initiative to supplement CarPoint. com and Ford. com it was called Ford Internet retail System (FIRST). FIRST was aimed at facilitating discourse of leads and orders between the company and its dealer network.This musical arrangement gave customers capability and options for buying a car manage never before, right from query to financing options. 4. Another e-commerce tool MyFord. com launched in February 2002, offered personalized service information like the maintenance schedules to owners All the above initiatives helped Ford to gain competitive advantage and they achieved the mint of the Build-to-Order (BTO) system that was conceived before the launch of e-commerce initiatives. It was estimated that a Web-enabled, BTO syste m could reduce diffusion be by almost USD 2,600 per vehicle.About USD 1,400 of these savings would be in physical cost such as freight, sales commissions, and advertising. The counterweight would be in phantom costs associated with the current push vehicle distribution/sales system, such as hurt discounts and stockout costs. Adding together all the supply-chain savings thus identified(back-end, on-line direct sales, and build-to-order) would produce an estimated hail potential cost reduction of about(predicate) USD 3,643 per vehicle, amounting to 14 percent of total vehicle cost. Source GS Research Analysis) With the means of e-business websites, Ford established a direct club with its customers. Now when customers came to FordDirect. com they had the ability of choosing the features of the car they precious to buy.This reduced the role of the middlemen and so dealers matte that they were being gradually excluded from the value chain. To nullify channel conflicts arising ou t of online retailing Ford began a number of initiatives. One of the main initiatives was to share the ownership of FordDirect. om with its 4200 dealers in the US. Ford also facilitated the communication of leads and orders between the company and its hugh dealer network through Ford Internet Retail System (FIRST). In addition to this, using MyFord. com the company enabled Ford dealers to inform vehicle owners about recommended maintenance, actuate them of oil change and provide information about tyre care, safety, insurance, loans and leases. It also provided dealers a vehicle locator tool to help them find a vehicle on another dealers stock.

Comfort Theory Research Paper

I chose this scenario which is divert for the natural covering of Kolcabas console possible action You ar a hold dear on an con oncology unit. Your longanimous is a 72-year-old competent anthropoid who has been told his potcer is final stage and that further treatment is unbelievable to have any benefit. He accepts that and would like to look for hospice. However, his two adult children insist that he should glide by chem separateapy and fight on and they tell you non to reason with him or get a consult for hospice. precise Concepts of the guess In order to address this scenario I used the middle cooking stove speculation of allayer and its specific concepts.This paper aims to describe the harbor guess, its action to the health c atomic number 18 setting and argonas for potential explore and its relevance to the health wish well system. pacifier is an fast desirable outcome that leads to excellent foreboding in the treat profession. Comfort is a vi tal art object of the treatment and recovery of forbearings. Comfort is a app arent motion of sleep from dis facilitate, a farming of resi payable and peace-loving satisfaction, a subject of pacifier and whatever makes manner pleasurable. (Kolcaba & Kolcaba, 1991). This hypothesis addresses the most relevant issues in the treat kingdom.Using this surmisal not just for affected federal agencys, barely for contains go away improve recruitment and retention judge of skilled health attention professionals. Providing console is a necessity in the fright of guests on in uncomplaining oncologic unit. Currently, blow is beingness viewed as a last result for terminally ill long-sufferings and not used as a standard hospital protocol or prophylactically to improve invitees health spatial relation. The main purpose of Comfort possibility is to improve patients satisfaction and outcomes as well as improve institutional integrity. As a middle range hypothesis, Comf ort surmise is practically based and an be used in transfer response to this specific clinical scenario that we as the advanced nurse practitioner exit participate. (Peterson & Bredow, 2009).Overview of the conjecture and Utility in Nursing practice session The theory of Comfort batch be utilized to contain and prove treat practice. In her theory she describes holistic shelter in three different forms relief, ease and transcendence as the immediate experience of being strengthened by having these necessary forms in intravenous feeding contexts physical, psycho- unearthly, socio-cultural which incorporate cultural traditions and family, and environmental. Goodwin, Sener & Steiner, 2007). Relief is when the patient has had a shelter need met. Ease is defined as a state of contentment, and transcendence is a state of comfort in which clients are able to raising above their challenges. (March & McCormack, 2009). The psycho-spiritual context refers to comfort of ones iden tity, sexuality, self esteem and any another(prenominal) spiritual relationship with a higher being. Socio-cultural comfort arises from interpersonal and societal relationships along with family. (Kolcaba, Tilton & Drouin, 2006).The author created a systematic bodily structure of three types of comfort integrated with the four contexts of experience, into a 12?cell grid. The grid is multipurpose for assessing patients require, planning interventions and evaluating their effectiveness, and aids to contri providede to the appreciation and utility of the theory. (Peterson & Bredow, 2009). Kolcabas proposes that when clients and family members feel more cheerful, they pass on engage in more health pursuit behaviors which include internal and external behaviors and a unruffled death.Internal behaviors occur at the cellular take aim, such as immune functioning. External behaviors refer to activities of daily living and health maintenance programs. When patients and family me mbers are benignant in more health seeking behaviors as a result of developmentd comfort due to interventions, members of the health make out team will be more content, will ultimately perform let on and improve institutional outcomes such as cut down costs of fright, reduced length of stay, elicitd fiscal stability and increased patient satisfaction. (Peterson and Bredow, 2009).Regarding the relevance to wish well for practice, comfort is a despotic outcome that is relate to an increase in health seeking behaviors and to positive institutional outcomes (Kolcaba & DiMarco, 2005). Nurses are constantly utilizing the comfort mechanisms and sweat to move patients towards the transcendence phase. Psychospiritual demand include principle confidence and motivation by discomfort. Ways that nurses smoke implement comfort measures are through massage, allowing visitation, condole with touch and continued encouragement (Kolcaba & DiMarco, 2005).Sociocultural comfort needs are the needs for cultural reasonable reassurance and positive body language. Nurses bunghole provide these needs through coaching, encouragement, and formulateing procedures. Nurses smoke help patients achieve the environmental comfort by lowering the lights, closing the doors, interrupting catnap minimally and limiting loud noise or so the patients rooms (Kolcaba & DiMarco, 2005). Nurses document patients states out front and after the use of comfort measures to verify if they are up(p) or worsening the clients hold.Nurses knowing a patients condition abide provide comfort measures to pr burden prohibit outcomes. If a patient is requesting hospice care, a nurse whitethorn be aware of the possibility of achieve this inclination. If the nurse notices an increase in pain, facial grimacing and anxiety, the nurse may realize that he should make some arrangements for hospice care. The nurse could also provide massage, guided imagery or other interventions based on the type of terminal preemptcer and intensity of the pain. Being able to chequer when comfort measures are useable is vital to improving the gauge of patient care.When patients are more comfortable, they are more likely to engage in health seeking behaviors, and to comply with medications and exercise regimes, increased conformity with prescribed diets and more calm deaths when palliative care is the appropriate goal. (March & McCormack, 2009). When patients increase their health seeking behaviors, nurses are more satisfied and improve their quality of care which increases the institutional integrity, and enhances the care of all health care professionals. Meaning of the TheoryI think the theory means that the role of breast feeding includes the assessment of comfort needs, the design of comfort actions to address those requirements, and the re-evaluation of comfort levels after accomplishment. In the model of Comfort, nursing is described as the process of assessing the patients comfort requirements, developing and implementing suitable plans of care, and evaluating the clients comfort after the care plans have been approved. Nursing estimate can be objective, such as the followup of the pale skin in our competent anthropoid client with cancer, or subjective, such as enquire if he is comfortable.The Theory of Comfort considers patients to be individuals, families, institutions, or communities in need of health care. The environment can be manipulated by a nurse or loved one in order to enhance comfort. In my opinion this theory is one of the sudden growing areas of current nursing theory improvement, and the most promising. The comfort theory can be kick in to patients of all ages, cultures backgrounds, or communities. It is also applicable to patients in the hospital, clinic or home. I believe that comfort is a positive concept and is associated with activities that nurture and fortify clients. check of the Research The Comfort theory has been well-tried i n many settings, used as a tail end of study and evaluated in several researches. It is necessary for this theory to be in the forefront of health care and research because it can greatly enhance patient outcomes. Though it has not necessarily been tested in all of these areas, it can be used to enhance any persons health status in any practice setting. The nurse investigator employing this theory will find it very useful because of its ease of application.The researcher can take this theory and apply it to whatever setting and it is well tested with a manakin of instruments including, General Comfort Questionnaire, truncated General Comfort Questionnaire, Visual Analogue Scales and Comfort Behavior Checklists. It provides direction for performance review, outcomes research and quality improvement (Kolcaba, Tilton & Drouin, 2006). As a middle range theory it has fewer concepts and propositions than a grand theory, is easily testable, easily applicable and interpret and more n arrow in background knowledge. The theory has a low level of abstraction.This theory is inactive in early development. Concepts, propositions, and outcomes of comfort are operationalized easily using the taxonomic structure of comfort. The theory is still being tested and apply to a wider institutional approach. Because Kolcabas theory has still not been adapted in all of the researched settings, the benefits and outcomes are currently just speculated. Research of this theory is on-going and constantly evolving. The theory is broad in reach because it can be applied to a variety of patient settings and patients of all ages and backgrounds.The theory can be viewed as being narrow in scope because it focuses solely on patient and families. However, it is easily extrapolated to other areas of practice. Once this occurs, the theory will be primarily viewed as being broad in scope. Researchers can test the benefits of comfort on learning. This theory does not necessarily have to inv olve just health care settings it can be utilise in any field with any member of the health care team (Goodwin, Sener & Steiner, 2007). Her theory is easily interpreted and applicable to patient settings.A traditional goal of nursing has been to attend to patient comfort. Patients expect this from nurses and come apart them credit when comfort is delivered. Through deliberate actions of nurses, patients dupe what they need and want from their nurses. The theory provides directionality for nursing practice because it provides measurable outcomes. However, the author mainly provides examples of comfort measures and how these work in the hospital. The author also relates comfort measures to improving health?seeking behaviors and benefiting institutions and institutional integrity.The theory addresses comfort and how it can improve patient outcomes, but fails to expand adequately on how these comfort measures can be used outside of the hospital setting. some researchers are taking t he Comfort Theory and extrapolating it to be useful in other health care settings. Comfort theory tested by nursing research all the relationships betwixt nursing interventions, patient comfort, health seeking behaviors and institutional integrity. Finally the theory include all health care providers and implemented as an institution-wide framework for practice. (Peterson & Bredow, 2009).Applications of the Theory and Solutions for the Scenario I apply the theory and developed specific solutions for the issues that are embossed in the scenario It is significant to specify if nurses and other health care providers implement this theory into their practice, patient outcomes will significantly improve. This theory will not unaccompanied enhance patient results, but it will help prevent imminent medical problems. We as a nurse assess the physical, psychospiritual, sociocultural and environmental needs of the clients, for example looking at deficits in the physiological mechanisms of this very ill patient due to an unserviceable cancer.Some physical comfort needs that can be treated without medications include pain, vomiting, anxiety and weakness. We can use different interventions to help alleviate these problems and increase patient satisfaction. The theory describes nursing practice as being holistic, human beingsistic and needs related. It describes different nursing interventions intended to promote comfort for the patients provided by nurses. This theory differentiates nursing from other health related disciplines by demonstrating the different types of comforting measures provided by the health care team.There is a role play in seeking the clients comfort by all members caring for the patient, including the client himself seeking his relief in a hospice once he take the comfort level desired through move in his quick recovery and exploring for a hospice. In this scenario, it will be the role of the nurses to help the client to achieve the desired com fort level by teaching the family members related to the convenience of the hospice care. We will explain the necessity of stop the chemotherapy.Lack of teaching in this extreme case may result to omit of comfort and lack of peace in the event of terminal illness and death. These solutions lead to recovery at a faster pace. It is crucial the provision of approximate environment to ensure that the client receives plenty comfort for his recovery. Therefore, the nurse play the leading role of identifying the clients comfort needs, and design interventions to address those needs. With indisputable comfort level the client acquires strength to participate in health seeking behaviors and if not, encounter unaggressive death.If specific comfort needs of a patient are met, the patient experiences relief and comfort, for example, a patient who receives pain medication in an inpatient oncologic unit. Ease addresses comfort in a state of contentment. For example, the patients concerns of h ospice care are addressed. Positive outcomes are achieved through the cooperation of all parties involved. The client should be cooperative to take on the desired energy in a comfortable manner, or die in a peaceful way due to his comfort level, if death occurs.Conclusions around Usefulness of the theory in Nursing Practice Kolcabas middle range theory of Comfort is applicable to all areas of the healthcare field and other nursing situations since it is currently patient and family centered. The theory is hypothecate to provide guidance for everyday practice and scholarly research rooted in the nursing rearing comforting the learner or student in an educational environment. This theory was created to guide for the assessment, dimension, and appraisal of patient comfort.There are a lot of benefits we can get in learning and applying Kolcabas Theory of Comfort as it promotes understanding and collaboration between health care team members addressing the current famine in health c are team. In addition, it will improve societal acceptance of the health institution and increase patient satisfaction. (March & McCormack, 2009) It is important to denote the application of it to an institution wide approach. I consider a limitation that Kolcaba restricts the use of interventions to provide comfort as a function of nurses.It is focused on a limited dimension of the reality of nursing. (March & McCormack, 2009). In the role of providing comfort, the nurses need to meet the basic physical, psychosocial and spiritual human needs throughout client comprehension to their experience. Theory of Comfort has a real potential to direct the work and thinking of all health care providers within one institution since, it appears that the comfort is ever present in all culture and appropriate universal goal for healthcare. It is a middle-range theory for health practice, education, and research. (Malinowski & Stamler, 2002).